Open AccessArticle Effect of the rs2590498 (A/G) Polymorphism of the OBPIIa Gene on the Olfactory Threshold and Perception Intensity of Fatty Acids Department of Biomedical Sciences, University of Cagliari, 09042 Monserrato, CA, Italy * Author to whom correspondence should be addressed. Foods 2026, 15(11), 2006; https://doi.org/10.3390/foods15112006 (registering DOI) Submission received: 13 May 2026 / Revised: 29 May 2026 / Accepted: 3 June 2026 / Published: 4 June 2026 Abstract The perception of the odor of fatty acids provides individuals with information about the nutritional content of foods. This perception varies depending on biological and genetic factors. Previous studies have shown that odorant binding proteins (OBPs) present in olfactory mucus play an important role in capturing and transporting odorants, typically lipophilic molecules, through the mucus to the olfactory receptors (ORs). The main objective of this research was to study the role of the rs2590498 (A/G) polymorphism of the human OBPIIa gene on the threshold and intensity of odor perception of palmitic (PA), oleic (OA) and linoleic (LA) acids. Volunteers were genotyped for OBP polymorphisms and classified as normosmic or hyposmic based on their threshold for n-butanol. The results show that normosmic or AA genotype participants perceived the odors of PA, OA, and LA at lower concentrations and with greater intensity than hyposmic or AG/GG genotype participants. Furthermore, the perception intensity reported by participants showed the following decreasing order: LA > OA > PA. These findings indicate that the intensity and threshold of perception depend on the lipophilicity of the molecule. These results indicate that genetic and biological factors, as well as the chemical properties of the molecules, play a key role in the olfactory perception of fatty acids. 1. Introduction Depending on environmental factors [ 18, 19, 20, 21], physiological factors [ 22, 23, 24, 25], pathological factors [ 26, 27, 28, 29, 30], and genetic factors [ 31, 32, 33, 34, 35], the olfactory function of individuals can vary from normosmia (normal function), to hyposmia (reduced or compromised function) or anosmia (totally or specifically absent function), both for complex stimuli and single molecules [ 36, 37, 38, 39, 40]. Among genetic factors, a key role in olfactory function is played by odorant binding proteins (OBPs) expressed in the perireceptor space of the olfactory epithelium [ 41, 42]. Several studies have suggested that odorants are captured and transported through the mucus layer by OBPs to olfactory receptors (ORs) present in the ciliated ends of the olfactory sensory neurons to facilitate OR/odorant binding [ 43, 44, 45, 46]. In particular, the human gene encoding OBPIIa presents a single nucleotide polymorphism, rs2590498 (A/G), which has been associated with significant variations in olfactory sensitivity. Individuals homozygous for the A allele show lower olfactory thresholds and report perceiving odors with higher intensities than individuals who were heterozygous or homozygous for the G allele, indicating a potential functional role of this polymorphism in modulating the olfactory response [ 42, 47, 48, 49]. Fatty acids commonly found in foods are primarily in the form of triglycerides, but at low concentrations they are also present as free fatty acids [ 50, 51]. Olfactory perception of long-chain fatty acids represents a topic of growing interest in human sensory physiology, as these molecules contribute to the aroma of foods, with implications for the regulation of food intake and in the evaluation of the nutritional quality of foods [ 52, 53]. Recent studies have shown that individuals are also able to perceive the odor of palmitic (C16:0), oleic (C18:1) and linoleic (C18:2) acids through the orthonasal pathway, and that the threshold and intensity of perception vary systematically between individuals and as a function of biological characteristics, such as sex and general olfactory function, as well as the properties of the molecules, such as their lipophilicity [ 54]. The ability to smell fatty acids from a distance represents an important evolutionary advantage because these molecules play important roles in biological systems in terms of energy reserves, cell membrane composition, thermoregulation, hormone synthesis and absorption of fat-soluble vitamins [ 55, 56, 57, 58, 59, 60, 61, 62]. Given the importance of dietary fatty acids and despite evidence of the involvement of the rs2590498 polymorphism in general olfactory perception, the specific role of the OBP genotype in the perception of long-chain fatty acids has not yet been clarified. Based on these premises, the primary aim of this study was to evaluate the effect of the rs2590498 (A/G) polymorphism of the human OBP gene (OBPIIa) on the threshold and intensity perception of palmitic, oleic, and linoleic acids in healthy individuals. Furthermore, since we had previously found that individual olfactory performance influences fatty acid perception, we investigated the presence of differences in fatty acid perception in individuals classified as normosmic or hyposmic based on their n-butanol threshold. Overall, the proposed integrated approach aims to elucidate the relative contribution of olfactory function and OBP polymorphism to the perception of long-chain fatty acids, helping to define the biological and genetic basis of interindividual variability in human olfaction. 2. Materials and Methods 2.1. Subjects All volunteers were asked not to eat, drink (except water), chew gum, and/or smoke for 2 h before the experiment. Each volunteer was required to arrive in the laboratory at least 15 min before the start of the tests to acclimatize to the environment, read the experimental protocol approved by the local ethics committee (Prot. PG/2021/14278, 22 September 2021) and sign an informed consent form. 2.2. Evaluation of n-Butanol Odor Threshold The odor threshold of participants was assessed using the n-butanol threshold test (Thre-test), one of the sub-tests of the Sniffin’ Sticks battery (Burghart Instruments, Wedel, Germany) [ 74]. The experimenter has 16 triplet pens, each consisting of two blanks filled with a solvent and one target pen containing n-butanol. The pens containing n-butanol have increasing concentrations from triplet 16 (lowest concentration) to triplet 1 (highest concentration). The participant is presented with the triplet with the lowest concentration, and the sequence continues until the pen containing n-butanol is identified twice. This represents the inversion point, or first reversal. The next step is to present triplets containing n-butanol at higher or lower concentrations until seven reversals are achieved. The average of the triplets from the last four reversals represents the n-butanol threshold score of each participant. The score assigned to each participant varies from 1 to 16 and allows them to be classified as normosmic or hyposmic [ 75]. 2.3. “Mass Spectrometry-Gas Chromatography-Olfactometry” (MS-GC-O) Technique The chromatographic column employed was an HP-INNOWax (30 m × 0.25 mm × 0.50 µm) (Agilent 19091N-233; Agilent Technologies, Santa Clara, CA, USA). The injector and MS interface temperatures were maintained at 250 °C and 260 °C, respectively. The oven temperature program was set as follows: 40 °C (0.2 min), then increased at 40 °C/min to 100 °C (held for 2 min), followed by a ramp of 10 °C/min to 200 °C (held for 2 min), and finally increased at 10 °C/min to 250 °C (held for 39 min). The chromatographic run lasted 58 min. 2.4. Determination of the Olfactory Threshold of Fatty Acids The solutions used for each of the fatty acids were chosen on the basis of previous studies and in accordance with their solubility: 0.75, 1.5, 3, 4.5, 6, 9 and 12 mM for palmitic acid (PA); 6, 12, 24, 48, 95, 190, and 380 mM for oleic acid (OA); 0.75, 1.5, 3, 6, 12, 24, and 48 mM for linoleic acid (LA) [ 54, 79]. For data analysis, the seven concentrations of each fatty acid, different due to their different solubilities, were identified as decreasing dilution steps from the highest (marked 1) to the lowest (marked 7). This procedure was chosen to be similar to that of the Thre-test with the n-butanol. The experiment involved seven sets of triplet blotting paper strips (1 × 6 cm). Each set included one strip filled with 20 µL of the fatty acid solution and two strips containing an equal volume of liquid paraffin oil. Participants were asked to identify the strip infused with the fatty acid (target strip). The test begins with the lowest concentration and progresses to higher concentrations until the participant identifies the target strip twice in a row. This is the starting point and represents the first reversal. The test is then decreased until the participant makes an error, and from that point onwards it increases again (second reversal). The sequence of reversals is repeated seven times, and the olfactory threshold is defined as the average of the dilutions of the last four reversals. Each triplet is presented at approximately 20 s intervals. The score assigned to each participant ranges from 1 to 7. 2.5. Genetic Analysis DNA was isolated from 2 mL of unstimulated whole saliva using the standard salting-out procedure. Briefly, samples were centrifuged at 13,000 rpm, and the pellet was resuspended in 500 μL of lysis buffer (1 M NaCl, 0.1 M Tris-HCl pH 8.0, 40 mM EDTA, 0.2% SDS) supplemented with proteinase K (5 μL, 50 mg/mL), followed by 2 h incubation at 56 °C. Proteins were precipitated using saturated sodium acetate (3 M, pH 8.0) and removed by centrifugation at 8000 rpm for 10 min. DNA was precipitated with 100% isopropanol, washed with 70% ethanol, air-dried, and resuspended in 50 μL of nuclease-free water. Genomic DNA was extracted using the QIAamp ପ୍ପ DNA Mini Kit (QIAGEN S.r.l., Milan, Italy) according to the manufacturer’s instructions. DNA yield, concentration, and purity were evaluated by measuring absorbance at 260 nm with a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Milan, Italy). Volunteer subjects were genotyped for the rs2590498 (A/G) polymorphism of the OBPIIa gene using a customized TaqMan ପ୍ପ SNP Genotyping Assay (code: 4332077, Applied Biosystems by Life Technologies Italia, Milan, Italy Europe BV), as previously described [ 42, 80]. PCR amplification was performed using two primers: a sense (forward) primer (GCCAGGCAGGGACAGA) and an antisense (reverse) primer (CTACACCTGAGACCCCACAAG). Two allele-specific TaqMan fluorescent probes (VIC-labeled probe: TCGGTGACATGAACC and FAM-labeled probe: TCGGTGACGTGAACC) were also used. PCR reactions were carried out in 96-well plates under fast thermal cycling conditions. Each reaction contained 10 ng of DNA, 1× TaqMan ପ୍ପ Genotyping Assay (code: 4332077), 1× TaqMan ପ୍ପ Genotyping Master Mix (code: 4371355), and nuclease-free water. Amplification and fluorescence detection were performed using the StepOne TM Real-Time PCR System, while genotype determination assignment was achieved by allelic discrimination analysis with Sequence Detection Software (Genotyping module, Applied Biosystems, version 2.3; Life Technologies Italia, Monza, Italy). All samples were analyzed in duplicate, with both positive and negative controls included in each plate run. Molecular analyses revealed that, among participants in the GC-O experiments, 23 subjects were AA homozygous, 16 heterozygous and 40 GG homozygous; meanwhile, among the participants in the experiments aimed at determining the olfactory threshold for fatty acids, we found 25 AA, 28 AG and 45 GG subjects. 2.6. Statistical Analysis One-way MANOVA was used to analyze the effect of n-butanol threshold status (n-butanol T-status) and of the OBPIIa genotype on the intensity with which individuals perceived the odors of fatty acids (during elution from the gas chromatographic column) and on the fatty acid detection threshold. Repeated-measures ANOVA was used to evaluate differences in the perceived intensity of fatty acid odors (during elution from the gas chromatographic column) and in fatty acid detection thresholds. Data were checked for homogeneity of variance, sphericity and normality. Post hoc comparisons were conducted with Fisher’s least significant difference (LSD) test; Duncan’s test was used in the case that the assumption of homogeneity of variance was violated. p values OA > PA for AA homozygous, heterozygous, and GG homozygous participants. Consequently, the perception threshold is inversely proportional to the number of double bonds: the lowest threshold for linoleic acid (polyunsaturated), intermediate for oleic acid (unsaturated) and highest for palmitic acid (saturated). These findings highlight that the water solubility of molecules and the OBPs genotype are central factors in their perception. Indeed, individuals with AA genotype are advantaged by the presence not only of a greater number of OBPs, but also of more functional ones; these, therefore, bind odorants more easily and a greater number of molecules interact with the ORs, activating a more intense signal transduction and coding cascade [ 88, 93]. Linoleic acid, being the most water soluble due to the number of double bonds, would be more easily captured by OBPs and a greater number of molecules would be transported to the ORs, making their binding and OSN activation more likely [ 94]. This would explain why even individuals with at least one G allele, and therefore with fewer and less functional OBPs, perceive linoleic acid more intensely than oleic acid, and the latter more intensely than palmitic acid. Previous studies have shown that the olfactory threshold of individuals is at least partially determined by the rs2590498 polymorphism of the gene encoding OBPIIa, the only one present in the human olfactory epithelium [ 41, 42]. Given the relationship we found between the OBPs genotype and fatty acid perception, the second aim of our work was to study the ability to perceive palmitic, oleic and linoleic acids in individuals classified as normosmic or hyposmic on the basis of their n-butanol T-status. The results we obtained show that normosmic individuals perceive the odor of all fatty acids considered more intensely than hyposmic individuals and also show a lower perception threshold (as indicated by the higher score obtained). In addition, for both categories of individuals, we observed that perception is directly proportional to the solubility of the molecules in water. Specifically, we found the following decreasing order of perceived intensity: PA OA > LA for normosmic individuals and PA > OA = LA for participants with hyposmia. In accordance with this, a relationship between the perception of fatty acids and the general olfactory function of individuals has previously been found [ 54]. Furthermore, this result is consistent with the finding that OBP genotype influences fatty acid perception, both in terms of intensity and threshold. It should be remembered that the degree of activation of OSNs at the peripheral level determines the intensity with which sensory information reaches the CNS and, therefore, the intensity with which a molecule is perceived. The fact that linoleic acid has the lowest perception threshold is consistent with its reduced lipophilicity: it is captured and transported more easily by OBPs and is therefore perceived with greater intensity. Conversely, palmitic acid is perceived with less intensity because, being the most lipophilic, it is less easily captured by OBPs and, consequently, has a higher threshold and a lower perception intensity. This aspect is very important in relation to the role that smell plays in the eating behavior of individuals [ 3, 5, 8, 13, 14]. Individuals with normosmia, having better olfactory function, appear to be able to better evaluate food composition and choose healthier and more functional foods. This hypothesis is supported by a previous study in which individuals with normosmia show greater adherence to the Mediterranean diet, characterized by a high consumption of fruits, vegetables, and monounsaturated fats and a reduced consumption of processed meat, refined sugars, and saturated fats [ 13, 87, 88, 89, 90]. Similarly, individuals with AA genotype, who show better olfactory function, may exhibit eating behavior similar to that of individuals with normal olfactory function, although further studies will be needed to test this hypothesis. However, this aspect could be partially compensated by the properties of food. Highly hydrophilic foods counteract reduced olfactory function because they move more easily in the perireceptor space and, therefore, have an equal opportunity to reach the ORs and activate the transduction and coding cascade that characterizes the receptor response. Conversely, highly lipophilic foods, when associated with reduced olfactory function, could be more easily chosen and pose a risk to human health. In fact, while palmitic acid (saturated) has been associated with cardiovascular risk, high blood levels of LDL cholesterol, insulin resistance and the onset of diabetes mellitus, oleic (unsaturated) and linoleic (polyunsaturated) acids, on the contrary, appear to reduce blood pressure, LDL cholesterol levels, inflammatory status and insulin resistance [ 55, 56, 57, 58, 60, 61, 62, 95, 96, 97, 98]. The lower lipophilicity of linoleic and oleic acid could therefore also represent an advantage for hyposmic individuals or those carrying at least one G allele, as it could allow them to more accurately evaluate the caloric content of foods and choose foods that are both calorie rich and healthy. This advantage is particularly important for linoleic acid which, as an essential fatty acid, cannot be synthesized in sufficient quantities through metabolic pathways and must be obtained through the diet [ 56]. 5. Conclusions The results of this study show that fatty acid perception is influenced by genetic factors (polymorphism of the OBPs gene), biological factors (individual odor threshold), and the chemical properties of the molecules (water solubility). Individuals with AA genotype, compared to those with at least one G allele, possess a greater number of functional OBPs and, consequently, have better olfactory function. We suggest that these individuals may perceive the odor of palmitic, oleic, and linoleic acids more intensely and at lower concentrations, facilitating the choice of foods rich in essential fatty acids and low in calories. Furthermore, the number of double bonds, which make the molecules more water-soluble and favor their interaction with OBPs, may also represent an advantage for individuals with AG or GG genotypes. Author Contributions Conceptualization, M.M., I.T.B., R.C. and G.S.; methodology, D.D. and M.M.; formal analysis, D.D. and G.S.; investigation, D.D.; resources, I.T.B., R.C. and G.S.; writing—original draft preparation, G.S.; writing—review and editing, D.D., M.M., I.T.B., R.C. and G.S.; supervision, G.S.; funding acquisition, D.D., M.M., I.T.B., R.C. and G.S. All authors have read and agreed to the published version of the manuscript. Funding The authors acknowledge support from the University of Cagliari under the Open Access funding call for the publication of this work. This research was partially supported by a grant from the University of Cagliari (Progetti biennali FdS—Bando 2021). Institutional Review Board Statement The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethical Committee of the University Hospital of Cagliari (Prot. PG/2021/14278, 22 September 2021). Informed Consent Statement Informed consent was obtained from all subjects involved in the study. Data Availability Statement The data presented in this study are available on request from the corresponding author. The data is not publicly available due to restrictions (e.g., privacy or ethical). Acknowledgments The authors thank the volunteers, without whose contribution this study would not have been possible. The authors acknowledge support from the University of Cagliari under the Open Access funding call for the publication of this work. Conflicts of Interest The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results. References Boesveldt, S.; de Graaf, K. The Differential Role of Smell and Taste For Eating Behavior. Perception 2017, 46, 307–319. [ Google Scholar] [ CrossRef] Boesveldt, S.; Parma, V. The importance of the olfactory system in human well-being, through nutrition and social behavior. Cell Tissue Res. 2021, 383, 559–567. [ Google Scholar] [ CrossRef] Duffy, V.B.; Backstrand, J.R.; Ferris, A.M. Olfactory dysfunction and related nutritional risk in free-living, elderly women. J. Am. Diet. Assoc. 1995, 95, 879–884; quiz 885–886. [ Google Scholar] [ CrossRef] Sollai, G.; Crnjar, R. Association among Olfactory Function, Lifestyle and BMI in Female and Male Elderly Subjects: A Cross-Sectional Study. Nutrients 2023, 15, 2492. [ Google Scholar] [ CrossRef] Stevenson, R.J. An initial evaluation of the functions of human olfaction. Chem. Senses 2010, 35, 3–20. [ Google Scholar] [ CrossRef] Velluzzi, F.; Deledda, A.; Onida, M.; Loviselli, A.; Crnjar, R.; Sollai, G. Relationship between Olfactory Function and BMI in Normal Weight Healthy Subjects and Patients with Overweight or Obesity. Nutrients 2022, 14, 1262. [ Google Scholar] [ CrossRef] [ PubMed] Lasschuijt, M.P.; de Graaf, K.; Mars, M. Effects of Oro-Sensory Exposure on Satiation and Underlying Neurophysiological Mechanisms-What Do We Know So Far? Nutrients 2021, 13, 1391. [ Google Scholar] [ CrossRef] Aschenbrenner, K.; Hummel, C.; Teszmer, K.; Krone, F.; Ishimaru, T.; Seo, H.S.; Hummel, T. The influence of olfactory loss on dietary behaviors. Laryngoscope 2008, 118, 135–144. [ Google Scholar] [ CrossRef] Drewnowski, A.; Dwyer, J.; King, J.C.; Weaver, C.M. A proposed nutrient density score that includes food groups and nutrients to better align with dietary guidance. Nutr. Rev. 2019, 77, 404–416. [ Google Scholar] [ CrossRef] Fazzino, T.L.; Rohde, K.; Sullivan, D.K. Hyper-Palatable Foods: Development of a Quantitative Definition and Application to the US Food System Database. Obesity 2019, 27, 1761–1768. [ Google Scholar] [ CrossRef] [ PubMed] Henkin, R.I. Effects of smell loss (hyposmia) on salt usage. Nutrition 2014, 30, 690–695. [ Google Scholar] [ CrossRef] [ PubMed] Mattes, R.D. Nutritional implications of the cephalic-phase salivary response. Appetite 2000, 34, 177–183. [ Google Scholar] [ CrossRef] Postma, E.; Graaf, C.; Boesveldt, S. Food preferences and intake in a population of Dutch individuals with self-reported smell loss: An online survey. Food Qual. Prefer. 2019, 79, 103771. [ Google Scholar] [ CrossRef] Velluzzi, F.; Deledda, A.; Lombardo, M.; Fosci, M.; Crnjar, R.; Grossi, E.; Sollai, G. Application of Artificial Neural Networks (ANN) to Elucidate the Connections among Smell, Obesity with Related Metabolic Alterations, and Eating Habit in Patients with Weight Excess. Metabolites 2023, 13, 206. [ Google Scholar] [ CrossRef] [ PubMed] Boone, M.H.; Liang-Guallpa, J.; Krashes, M.J. Examining the role of olfaction in dietary choice. Cell Rep. 2021, 34, 108755. [ Google Scholar] [ CrossRef] Manesse, C.; Ferdenzi, C.; Sabri, M.; Bessy, M.; Rouby, C.; Faure, F.; Bellil, D.; Jomain, S.; Landis, B.N.; Hugentobler, M.; et al. Dysosmia-Associated Changes in Eating Behavior. Chemosens. Percept. 2017, 10, 104–113. [ Google Scholar] [ CrossRef] Rawal, S.; Duffy, V.B.; Berube, L.; Hayes, J.E.; Kant, A.K.; Li, C.-M.; Graubard, B.I.; Hoffman, H.J. Self-Reported Olfactory Dysfunction and Diet Quality: Findings from the 2011–2014 National Health and Nutrition Examination Survey (NHANES). Nutrients 2021, 13, 4561. [ Google Scholar] [ CrossRef] Calderón-Garcidueñas, L.; Franco-Lira, M.; Henríquez-Roldán, C.; Osnaya, N.; González-Maciel, A.; Reynoso-Robles, R.; Villarreal-Calderon, R.; Herritt, L.; Brooks, D.; Keefe, S.; et al. Urban air pollution: Influences on olfactory function and pathology in exposed children and young adults. Exp. Toxicol. Pathol. Off. J. Ges. Fur Toxikol. Pathol. 2010, 62, 91–102. [ Google Scholar] [ CrossRef] Sorokowska, A.; Sorokowski, P.; Hummel, T.; Huanca, T. Olfaction and environment: Tsimane’ of Bolivian rainforest have lower threshold of odor detection than industrialized German people. PLoS ONE 2013, 8, e69203. [ Google Scholar] [ CrossRef] Scussiatto, H.O.; da Silva, J.L.B.; Figueiredo, A.F.; Ramos, R.A.M.R.; de Rezende Pinna, F.; Voegels, R.L.; Pinto, J.M.; Fornazieri, M.A. Association of air pollution with olfactory identification performance of São Paulo residents: A cross-sectional study. Int. Arch. Occup. Environ. Health 2023, 96, 621–628. [ Google Scholar] [ CrossRef] Doty, R.L.; Petersen, I.; Mensah, N.; Christensen, K. Genetic and environmental influences on odor identification ability in the very old. Psychol. Aging 2011, 26, 864–871. [ Google Scholar] [ CrossRef] Attems, J.; Walker, L.; Jellinger, K.A. Olfaction and Aging: A Mini-Review. Gerontology 2015, 61, 485–490. [ Google Scholar] [ CrossRef] Min, H.J.; Kim, S.M.; Han, D.H.; Kim, K.S. The sniffing bead system, an olfactory dysfunction screening tool for geriatric subjects: A cross-sectional study. BMC Geriatr. 2021, 21, 54. [ Google Scholar] [ CrossRef] Öberg, C.; Larsson, M.; Bäckman, L. Differential sex effects in olfactory functioning: The role of verbal processing. J. Int. Neuropsychol. Soc. 2002, 8, 691–698. [ Google Scholar] [ CrossRef] Sorokowski, P.; Karwowski, M.; Misiak, M.; Marczak, M.K.; Dziekan, M.; Hummel, T.; Sorokowska, A. Sex Differences in Human Olfaction: A Meta-Analysis. Front. Psychol. 2019, 10, 342. [ Google Scholar] [ CrossRef] Patel, Z.M.; DelGaudio, J.M.; Wise, S.K. Higher Body Mass Index Is Associated with Subjective Olfactory Dysfunction. Behav. Neurol. 2015, 2015, 675635. [ Google Scholar] [ CrossRef] Walliczek-Dworschak, U.; Wendler, J.; Khan, T.; Aringer, M.; Hähner, A.; Hummel, T. Chemosensory function is decreased in rheumatoid arthritis. Eur. Arch. Otorhinolaryngol. 2020, 277, 1675–1680. [ Google Scholar] [ CrossRef] [ PubMed] Wilson, R.S.; Arnold, S.E.; Schneider, J.A.; Boyle, P.A.; Buchman, A.S.; Bennett, D.A. Olfactory impairment in presymptomatic Alzheimer’s disease. Ann. N. Y. Acad. Sci. 2009, 1170, 730–735. [ Google Scholar] [ CrossRef] [ PubMed] Sollai, G.; Melis, M.; Mastinu, M.; Paduano, D.; Chicco, F.; Magri, S.; Usai, P.; Hummel, T.; Barbarossa, I.T.; Crnjar, R. Olfactory Function in Patients with Inflammatory Bowel Disease (IBD) Is Associated with Their Body Mass Index and Polymorphism in the Odor Binding-Protein (OBPIIa) Gene. Nutrients 2021, 13, 703. [ Google Scholar] [ CrossRef] [ PubMed] Velayudhan, L. Smell identification function and Alzheimer’s disease: A selective review. Curr. Opin. Psychiatry 2015, 28, 173–179. [ Google Scholar] [ CrossRef] Hasin-Brumshtein, Y.; Lancet, D.; Olender, T. Human olfaction: From genomic variation to phenotypic diversity. Trends Genet. 2009, 25, 178–184. [ Google Scholar] [ CrossRef] [ PubMed] Keller, A.; Zhuang, H.; Chi, Q.; Vosshall, L.B.; Matsunami, H. Genetic variation in a human odorant receptor alters odour perception. Nature 2007, 449, 468–472. [ Google Scholar] [ CrossRef] [ PubMed] Melis, M.; Mastinu, M.; Sollai, G. Effect of the rs2821557 Polymorphism of the Human Kv1.3 Gene on Olfactory Function and BMI in Different Age Groups. Nutrients 2024, 16, 821. [ Google Scholar] [ CrossRef] [ PubMed] Melis, M.; Tomassini Barbarossa, I.; Crnjar, R.; Sollai, G. Olfactory Sensitivity Is Associated with Body Mass Index and Polymorphism in the Voltage-Gated Potassium Channels Kv1.3. Nutrients 2022, 14, 4986. [ Google Scholar] [ CrossRef] Silva Teixeira, C.S.; Cerqueira, N.M.; Silva Ferreira, A.C. Unravelling the Olfactory Sense: From the Gene to Odor Perception. Chem. Senses 2016, 41, 105–121. [ Google Scholar] [ CrossRef] Crnjar, R.; Solari, P.; Sollai, G. The Human Nose as a Chemical Sensor in the Perception of Coffee Aroma: Individual Variability. Chemosensors 2023, 11, 248. [ Google Scholar] [ CrossRef] Croy, I.; Nordin, S.; Hummel, T. Olfactory Disorders and Quality of Life—An Updated Review. Chem. Senses 2014, 39, 185–194. [ Google Scholar] [ CrossRef] Jafek, B.W.; Gordon, A.S.; Moran, D.T.; Eller, P.M. Congenital anosmia. Ear Nose Throat J. 1990, 69, 331–337. [ Google Scholar] O’Connell, R.J.; Stevens, D.A.; Akers, R.P.; Coppola, D.M.; Grant, A.J. Individual differences in the quantitative and qualitative responses of human subjects to various odors. Chem. Senses 1989, 14, 293–302. [ Google Scholar] [ CrossRef] Manan, H.A.; Yahya, N.; Han, P.; Hummel, T. A systematic review of olfactory-related brain structural changes in patients with congenital or acquired anosmia. Brain Struct. Funct. 2022, 227, 177–202. [ Google Scholar] [ CrossRef] Briand, L.; Eloit, C.; Nespoulous, C.; Bézirard, V.; Huet, J.C.; Henry, C.; Blon, F.; Trotier, D.; Pernollet, J.C. Evidence of an odorant-binding protein in the human olfactory mucus: Location, structural characterization, and odorant-binding properties. Biochemistry 2002, 41, 7241–7252. [ Google Scholar] [ CrossRef] Sollai, G.; Melis, M.; Magri, S.; Usai, P.; Hummel, T.; Tomassini Barbarossa, I.; Crnjar, R. Association between the rs2590498 polymorphism of Odorant Binding Protein (OBPIIa) gene and olfactory performance in healthy subjects. Behav. Brain Res. 2019, 372, 112030. [ Google Scholar] [ CrossRef] Archunan, G. Odorant Binding Proteins: A key player in the sense of smell. Bioinformation 2018, 14, 36–37. [ Google Scholar] [ CrossRef] Boichot, V.; Muradova, M.; Nivet, C.; Proskura, A.; Heydel, J.-M.; Canivenc-Lavier, M.-C.; Canon, F.; Neiers, F.; Schwartz, M. The role of perireceptor events in flavor perception. Front. Food Sci. Technol. 2022, 2, 989291. [ Google Scholar] [ CrossRef] Heydel, J.M.; Coelho, A.; Thiebaud, N.; Legendre, A.; Bon, A.M.L.; Faure, P.; Neiers, F.; Artur, Y.; Golebiowski, J.; Briand, L. Odorant-binding proteins and xenobiotic metabolizing enzymes: Implications in olfactory perireceptor events. Anat. Rec. 2013, 296, 1333–1345. [ Google Scholar] [ CrossRef] Pelosi, P. The role of perireceptor events in vertebrate olfaction. Cell. Mol. Life Sci. 2001, 58, 503–509. [ Google Scholar] [ CrossRef] [ PubMed] Diana, D.; Melis, M.; Solari, P.; Tomassini Barbarossa, I.; Crnjar, R.; Sollai, G. Human perception of coffee aroma and its odor-active molecules: Role of the olfactory threshold and the OBPIIa gene. Food Res. Int. 2026, 237, 119339. [ Google Scholar] [ CrossRef] Melis, M.; Tomassini Barbarossa, I.; Hummel, T.; Crnjar, R.; Sollai, G. Effect of the rs2890498 polymorphism of the OBPIIa gene on the human ability to smell single molecules. Behav. Brain Res. 2021, 402, 113127. [ Google Scholar] [ CrossRef] [ PubMed] Sollai, G.; Melis, M.; Tomassini Barbarossa, I.; Crnjar, R. A polymorphism in the human gene encoding OBPIIa affects the perceived intensity of smelled odors. Behav. Brain Res. 2022, 427, 113860. [ Google Scholar] [ CrossRef] Bolton, B.; Halpern, B.P. Orthonasal and retronasal but not oral-cavity-only discrimination of vapor-phase fatty acids. Chem. Senses 2010, 35, 229–238. [ Google Scholar] [ CrossRef] Lobb, K.; Chow, C. Fatty Acid Classification and Nomenclature. In Fatty Acids in Foods and Their Health Implications; CRC Press: Boca Raton, FL, USA, 2007; pp. 1–15. [ Google Scholar] Boesveldt, S.; Lundström, J.N. Detecting fat content of food from a distance: Olfactory-based fat discrimination in humans. PLoS ONE 2014, 9, e85977. [ Google Scholar] [ CrossRef] Drewnowski, A. Why do we like fat? J. Am. Diet. Assoc. 1997, 97, S58–S62. [ Google Scholar] [ CrossRef] [ PubMed] Diana, D.; Sollai, G. Odor of Fatty Acids: Differences in Threshold and Perception Intensity Between Sexes. Foods 2025, 14, 2777. [ Google Scholar] [ CrossRef] Bazinet, R.P.; Layé, S. Polyunsaturated fatty acids and their metabolites in brain function and disease. Nat. Rev. Neurosci. 2014, 15, 771–785. [ Google Scholar] [ CrossRef] Calder, P.C. Functional Roles of Fatty Acids and Their Effects on Human Health. J. Parenter. Enter. Nutr. 2015, 39, 18S–32S. [ Google Scholar] [ CrossRef] [ PubMed] Dyall, S.C.; Balas, L.; Bazan, N.G.; Brenna, J.T.; Chiang, N.; da Costa Souza, F.; Dalli, J.; Durand, T.; Galano, J.-M.; Lein, P.J.; et al. Polyunsaturated fatty acids and fatty acid-derived lipid mediators: Recent advances in the understanding of their biosynthesis, structures, and functions. Prog. Lipid Res. 2022, 86, 101165. [ Google Scholar] [ CrossRef] [ PubMed] Harayama, T.; Shimizu, T. Roles of polyunsaturated fatty acids, from mediators to membranes. J. Lipid Res. 2020, 61, 1150–1160. [ Google Scholar] [ CrossRef] Heinze, J.M.; Costanzo, A.; Baselier, I.; Fritsche, A.; Lidolt, M.; Hinrichs, J.; Frank-Podlech, S.; Keast, R. Oil Perception-Detection Thresholds for Varying Fatty Stimuli and Inter-individual Differences. Chem. Senses 2017, 42, 585–592. [ Google Scholar] [ CrossRef] Kapoor, B.; Kapoor, D.; Gautam, S.; Singh, R.; Bhardwaj, S. Dietary Polyunsaturated Fatty Acids (PUFAs): Uses and Potential Health Benefits. Curr. Nutr. Rep. 2021, 10, 232–242. [ Google Scholar] [ CrossRef] Mititelu, M.; Lupuliasa, D.; Neacșu, S.M.; Olteanu, G.; Busnatu, Ș.S.; Mihai, A.; Popovici, V.; Măru, N.; Boroghină, S.C.; Mihai, S.; et al. Polyunsaturated Fatty Acids and Human Health: A Key to Modern Nutritional Balance in Association with Polyphenolic Compounds from Food Sources. Foods 2025, 14, 46. [ Google Scholar] [ CrossRef] Sioen, I.; van Lieshout, L.; Eilander, A.; Fleith, M.; Lohner, S.; Szommer, A.; Petisca, C.; Eussen, S.; Forsyth, S.; Calder, P.C.; et al. Systematic Review on N-3 and N-6 Polyunsaturated Fatty Acid Intake in European Countries in Light of the Current Recommendations—Focus on Specific Population Groups. Ann. Nutr. Metab. 2017, 70, 39–50. [ Google Scholar] [ CrossRef] Aydin, N.; Ramazanoglu, L.; Onen, M.R.; Yilmaz, I.; Aydin, M.D.; Altinkaynak, K.; Calik, M.; Kanat, A. Rationalization of the Irrational Neuropathologic Basis of Hypothyroidism-Olfaction Disorders Paradox: Experimental Study. World Neurosurg. 2017, 107, 400–408. [ Google Scholar] [ CrossRef] Besser, G.; Erlacher, B.; Aydinkoc-Tuzcu, K.; Liu, D.T.; Pablik, E.; Niebauer, V.; Koenighofer, M.; Renner, B.; Mueller, C.A. Body-Mass-Index Associated Differences in Ortho- and Retronasal Olfactory Function and the Individual Significance of Olfaction in Health and Disease. J. Clin. Med. 2020, 9, 366. [ Google Scholar] [ CrossRef] Chamberlin, K.W.; Yuan, Y.; Li, C.; Luo, Z.; Reeves, M.; Kucharska-Newton, A.; Pinto, J.M.; Ma, J.; Simonsick, E.M.; Chen, H. Olfactory Impairment and the Risk of Major Adverse Cardiovascular Outcomes in Older Adults. J. Am. Heart Assoc. 2024, 13, e033320. [ Google Scholar] [ CrossRef] Croy, I.; Symmank, A.; Schellong, J.; Hummel, C.; Gerber, J.; Joraschky, P.; Hummel, T. Olfaction as a marker for depression in humans. J. Affect. Disord. 2014, 160, 80–86. [ Google Scholar] [ CrossRef] [ PubMed] Jacobson, P.T.; Vilarello, B.J.; Tervo, J.P.; Waring, N.A.; Gudis, D.A.; Goldberg, T.E.; Devanand, D.P.; Overdevest, J.B. Associations between olfactory dysfunction and cognition: A scoping review. J. Neurol. 2024, 271, 1170–1203. [ Google Scholar] [ CrossRef] Kouzuki, M.; Suzuki, T.; Nagano, M.; Nakamura, S.; Katsumata, Y.; Takamura, A.; Urakami, K. Comparison of olfactory and gustatory disorders in Alzheimer’s disease. Neurol. Sci. 2018, 39, 321–328. [ Google Scholar] [ CrossRef] Palouzier-Paulignan, B.; Lacroix, M.C.; Aimé, P.; Baly, C.; Caillol, M.; Congar, P.; Julliard, A.K.; Tucker, K.; Fadool, D.A. Olfaction under metabolic influences. Chem. Senses 2012, 37, 769–797. [ Google Scholar] [ CrossRef] [ PubMed] Potter, M.R.; Chen, J.H.; Lobban, N.S.; Doty, R.L. Olfactory dysfunction from acute upper respiratory infections: Relationship to season of onset. Int. Forum Allergy Rhinol. 2020, 10, 706–712. [ Google Scholar] [ CrossRef] [ PubMed] Ross, G.W.; Petrovitch, H.; Abbott, R.D.; Tanner, C.M.; Popper, J.; Masaki, K.; Launer, L.; White, L.R. Association of olfactory dysfunction with risk for future Parkinson’s disease. Ann. Neurol. 2008, 63, 167–173. [ Google Scholar] [ CrossRef] Sasaki, H.; Tamura, K.; Naito, Y.; Ogata, K.; Mogi, A.; Tanaka, T.; Ikari, Y.; Masaki, M.; Nakashima, Y.; Takamatsu, Y. Patient perceptions of symptoms and concerns during cancer chemotherapy: ‘affects my family’ is the most important. Int. J. Clin. Oncol. 2017, 22, 793–800. [ Google Scholar] [ CrossRef] Wang, W.; Li, Z.; Zhang, X.; Li, Y.; Kong, S.; Zou, B.; Wang, M.; Cheng, N.; Zhang, H.M.; Sun, J. Investigating factors influencing subjective taste and smell alterations in colorectal cancer patients. Support. Care Cancer 2025, 33, 205. [ Google Scholar] [ CrossRef] [ PubMed] Hummel, T.; Sekinger, B.; Wolf, S.R.; Pauli, E.; Kobal, G. ‘Sniffin’ sticks’: Olfactory performance assessed by the combined testing of odor identification, odor discrimination and olfactory threshold. Chem. Senses 1997, 22, 39–52. [ Google Scholar] [ CrossRef] [ PubMed] Hummel, T.; Kobal, G.; Gudziol, H.; Mackay-Sim, A. Normative data for the “Sniffin’ Sticks” including tests of odor identification, odor discrimination, and olfactory thresholds: An upgrade based on a group of more than 3000 subjects. Eur. Arch. Otorhinolaryngol. 2007, 264, 237–243. [ Google Scholar] [ CrossRef] [ PubMed] Sollai, G.; Tomassini Barbarossa, I.; Usai, P.; Hummel, T.; Crnjar, R. Association between human olfactory performance and ability to detect single compounds in complex chemical mixtures. Physiol. Behav. 2020, 217, 112820. [ Google Scholar] [ CrossRef] Nuzzi, M.; Lo Scalzo, R.; Testoni, A.; Rizzolo, A. Evaluation of Fruit Aroma Quality: Comparison Between Gas Chromatography–Olfactometry (GC–O) and Odour Activity Value (OAV) Aroma Patterns of Strawberries. Food Anal. Methods 2008, 1, 270–282. [ Google Scholar] [ CrossRef] van Ruth, S.M.; O’Connor, C.H. Evaluation of three gas chromatography-olfactometry methods: Comparison of odour intensity-concentration relationships of eight volatile compounds with sensory headspace data. Food Chem. 2001, 74, 341–347. [ Google Scholar] [ CrossRef] Kindleysides, S.; Beck, K.L.; Walsh, D.C.I.; Henderson, L.; Jayasinghe, S.N.; Golding, M.; Breier, B.H. Fat Sensation: Fatty Acid Taste and Olfaction Sensitivity and the Link with Disinhibited Eating Behaviour. Nutrients 2017, 9, 879. [ Google Scholar] [ CrossRef] Tomassini Barbarossa, I.; Ozdener, M.H.; Melania; Love-Gregory, L.; Mitreva, M.; Abumrad, N.A.; Pepino, M.Y. Variant in a common odorant-binding protein gene is associated with bitter sensitivity in people. Behav. Brain Res. 2017, 329, 200–204. [ Google Scholar] [ CrossRef] Bolhuis, D.P.; Lakemond, C.M.; de Wijk, R.A.; Luning, P.A.; de Graaf, C. Effect of salt intensity in soup on ad libitum intake and on subsequent food choice. Appetite 2012, 58, 48–55. [ Google Scholar] [ CrossRef] Ramaekers, M.G.; Boesveldt, S.; Lakemond, C.M.; van Boekel, M.A.; Luning, P.A. Odors: Appetizing or satiating? Development of appetite during odor exposure over time. Int. J. Obes. 2014, 38, 650–656. [ Google Scholar] [ CrossRef] Ruijschop, R.M.; Boelrijk, A.E.; de Ru, J.A.; de Graaf, C.; Westerterp-Plantenga, M.S. Effects of retro-nasal aroma release on satiation. Br. J. Nutr. 2008, 99, 1140–1148. [ Google Scholar] [ CrossRef] [ PubMed] Ludwig, D.S.; Aronne, L.J.; Astrup, A.; de Cabo, R.; Cantley, L.C.; Friedman, M.I.; Heymsfield, S.B.; Johnson, J.D.; King, J.C.; Krauss, R.M.; et al. The carbohydrate-insulin model: A physiological perspective on the obesity pandemic. Am. J. Clin. Nutr. 2021, 114, 1873–1885. [ Google Scholar] [ CrossRef] [ PubMed] Alarcon, G.; Roco, J.; Medina, M.; Medina, A.; Peral, M.; Jerez, S. High fat diet-induced metabolically obese and normal weight rabbit model shows early vascular dysfunction: Mechanisms involved. Int. J. Obes. 2018, 42, 1535–1543. [ Google Scholar] [ CrossRef] [ PubMed] Lahey, R.; Khan, S.S. Trends in Obesity and Risk of Cardiovascular Disease. Curr. Epidemiol. Rep. 2018, 5, 243–251. [ Google Scholar] [ CrossRef] Neeland, I.J.; Ross, R.; Després, J.P.; Matsuzawa, Y.; Yamashita, S.; Shai, I.; Seidell, J.; Magni, P.; Santos, R.D.; Arsenault, B.; et al. Visceral and ectopic fat, atherosclerosis, and cardiometabolic disease: A position statement. Lancet Diabetes Endocrinol. 2019, 7, 715–725. [ Google Scholar] [ CrossRef] Breer, H. Odor recognition and second messenger signaling in olfactory receptor neurons. Semin. Cell Biol. 1994, 5, 25–32. [ Google Scholar] [ CrossRef] Melis, M.; Sollai, G.; Masala, C.; Pisanu, C.; Cossu, G.; Melis, M.; Sarchioto, M.; Oppo, V.; Morelli, M.; Crnjar, R.; et al. Odor Identification Performance in Idiopathic Parkinson’s Disease Is Associated with Gender and the Genetic Variability of the Olfactory Binding Protein. Chem. Senses 2019, 44, 311–318. [ Google Scholar] [ CrossRef] Pelosi, P. Odorant-binding proteins. Crit. Rev. Biochem. Mol. Biol. 1994, 29, 199–228. [ Google Scholar] [ CrossRef] Pelosi, P. Perireceptor events in olfaction. J. Neurobiol. 1996, 30, 3–19. [ Google Scholar] [ CrossRef] Pevsner, J.; Hwang, P.M.; Sklar, P.B.; Venable, J.C.; Snyder, S.H. Odorant-binding protein and its mRNA are localized to lateral nasal gland implying a carrier function. Proc. Natl. Acad. Sci. USA 1988, 85, 2383–2387. [ Google Scholar] [ CrossRef] Breer, H. Olfactory receptors: Molecular basis for recognition and discrimination of odors. Anal. Bioanal. Chem. 2003, 377, 427–433. [ Google Scholar] [ CrossRef] Cooper, G.M. The Cell: A Molecular Approach, 2nd ed.; Sinauer Associates: Sunderland, MA, USA, 2000. [ Google Scholar] D’Innocenzo, S.; Biagi, C.; Lanari, M. Obesity and the Mediterranean Diet: A Review of Evidence of the Role and Sustainability of the Mediterranean Diet. Nutrients 2019, 11, 1306. [ Google Scholar] [ CrossRef] Martínez-González, M.A.; Gea, A.; Ruiz-Canela, M. The Mediterranean Diet and Cardiovascular Health. Circ. Res. 2019, 124, 779–798. [ Google Scholar] [ CrossRef] Martínez-González, M.A.; Salas-Salvadó, J.; Estruch, R.; Corella, D.; Fitó, M.; Ros, E. Benefits of the Mediterranean Diet: Insights From the PREDIMED Study. Prog. Cardiovasc. Dis. 2015, 58, 50–60. [ Google Scholar] [ CrossRef] Schwingshackl, L.; Schwedhelm, C.; Galbete, C.; Hoffmann, G. Adherence to Mediterranean Diet and Risk of Cancer: An Updated Systematic Review and Meta-Analysis. Nutrients 2017, 9, 1063. [ Google Scholar] [ CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. © 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license. Shar