Open AccessArticle The SQSTM1/ p62 of Pacific White Shrimp ( Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture, Fisheries College, Guangdong Ocean University, Zhanjiang 524088, China * Author to whom correspondence should be addressed. Animals 2026, 16(11), 1718; https://doi.org/10.3390/ani16111718 (registering DOI) Submission received: 18 April 2026 / Revised: 31 May 2026 / Accepted: 1 June 2026 / Published: 4 June 2026 Simple Summary Ammonia accumulation is a common problem in shrimp aquaculture and can cause oxidative stress and tissue damage. p62 is a selective autophagy receptor involved in protein degradation and oxidative stress regulation, but its role in Pacific white shrimp ( Litopenaeus vannamei) under ammonia exposure remains unclear. In this study, Lv-p62 responded to ammonia exposure in different tissues. Knockdown of Lv-p62 changed the expression of genes related to antioxidant defense, autophagy, and apoptosis, and reduced hepatopancreatic injury and apoptosis. These findings suggest that Lv-p62 is involved in shrimp responses to ammonia stress and may help improve our understanding of how shrimp cope with ammonia stress in aquaculture. Abstract Ammonia exposure can induce oxidative stress in aquatic animals. The p62 protein is a selective autophagy receptor that participates in protein degradation and oxidative stress regulation. In this study, the role of Lv-p62 in the response of Litopenaeus vannamei to ammonia exposure was investigated using RNA interference. The results showed that Lv-p62 expression was significantly induced in the hepatopancreas, gills, and intestine of L. vannamei after ammonia exposure ( p < 0.05). Lv-p62 expression peaked at 6 h in the gills and 24 h in the intestine, whereas a biphasic response was observed in the hepatopancreas, with an initial peak at 12 h and a higher second peak at 48 h. In the RNAi experiment, Lv-p62 knockdown altered the expression of antioxidant-related genes ( Trx, Gst, and Gpx) in a tissue-specific manner, with Gpx expression being prominently increased in the gills and intestine but not in the hepatopancreas under ammonia exposure. Autophagy-related genes ( ATG4ATG10) also showed time-dependent and tissue-specific expression changes after Lv-p62 knockdown. The expression of apoptosis-related genes, including caspase 3p53, was tissue-specific and was generally lower in the dsRNA- Lv-p62+NH 3 group than in the dsRNA-EGFP+NH 3 group at most time points. Histopathological observations showed that hepatopancreatic acinar vacuolation and structural damage were alleviated, and the hepatopancreatic apoptosis rate was reduced in L. vannamei in the dsRNA- Lv-p62+NH 3 group. These findings suggest that Lv-p62 participates in the response of L. vannamei to ammonia exposure, possibly by regulating antioxidant defense, autophagy-related processes, and apoptosis, thereby affecting hepatopancreatic oxidative damage and tissue injury. Keywords: autophagy; apoptosis; aquaculture; environmental toxicant; histopathology Litopenaeus vannamei has become one of the most economically valuable aquaculture species worldwide, but it is susceptible to multiple environmental stressors, including salinity, temperature and ammonia [ 1, 2]. Notably, ammonia exposure is a major environmental stressor that severely impacts the health status of aquatic animals, thereby increasing susceptibility to pathogens and raising mortality rates [ 3]. In aquatic environments, ammonia occurs in two main forms, unionized NH 3 and ionized NH 4+, with their ratio largely regulated by water pH [ 4]. In this study, ammonium chloride (NH 4Cl) was used to establish ammonia stress. At an experimental pH of around 8.0, dissolved NH 4Cl dissociates and reaches chemical equilibrium between NH 4+ and toxic free NH 3 [ 4]. Since NH 3 easily penetrates biological membranes, it is regarded as the primary toxic form responsible for impairing aquatic animal health [ 5]. Specifically, ammonia could lead to oxidative stress in L. vannamei by increasing the concentration of reactive oxygen species (ROS) in hemocytes, and subsequently induce hepatopancreas damage [ 6, 7]. Excessive ROS accumulation induced by ammonia stress disrupts intracellular redox homeostasis, thereby causing oxidative damage [ 6, 7]. Oxidative stress not only impairs growth performance and immune function of shrimp [ 8], but also leads to mass mortality resulting in substantial economic losses to the aquaculture industry. Therefore, it is of great practical significance to deeply explore the regulatory mechanisms of the antioxidant system in L. vannamei under ammonia stress. Autophagy is the process by which cells degrade damaged or redundant cellular components through lysosomes and is essential for maintaining cellular homeostasis [ 9]. Sequestosome 1 (SQSTM1), also known as p62, is a selective autophagy cargo receptor that recognizes ubiquitinated proteins or damaged organelles as autophagic cargo and links them to autophagosomes for subsequent lysosomal degradation [ 10]. Notably, it also regulates the antioxidant response via the nuclear factor E2-related factor 2/antioxidant response elements (Nrf2/ARE) pathway [ 11]. Mechanistically, accumulated p62 can interact with Keap1, reduce Keap1-mediated repression of Nrf2, and promote Nrf2-dependent transcription of antioxidant genes. In addition, p62 is closely related to pro-inflammatory and anti-inflammatory pathways [ 12]. Previous studies have shown that Lv-p62 possesses conserved PB1 and UBA domains, which are associated with p62 oligomerization and recognition of ubiquitinated cargo, respectively [ 13]. This structural conservation supports the potential functional similarity of Lv-p62 to p62 homologs in other species. In addition to its role in autophagy, p62 has also been implicated in the regulation of antioxidant responses in several aquatic species, although the detailed mechanism in L. vannamei remains unclear. Given that oxidative stress is a key trigger of autophagy [ 14], p62 may serve as a critical integrator linking autophagy and antioxidant responses under environmental stress. Overexpression of p62 activated the Nrf2/ARE signaling pathway through the degradation of Keap1 [ 11]. In Cristaria plicata, RNA interference (RNAi) of p62 resulted in inhibiting the expression of Nrf2 and NADH quinone oxidoreductase 1 ( NQO1), indicating that p62 promoted the Nrf2/ARE pathway to protect against oxidative stress [ 15]. Previous studies have shown that waterborne zinc exposure can alter the transcriptional responses of autophagy-related genes, including p62, in yellow catfish [ 16]. This may be associated with heavy metal-induced oxidative stress, which activates autophagy-related pathways and thereby modulates p62 expression as part of the cellular clearance response. In common carp ( Cyprinus carpio), two p62 genes, Ccp62-1Ccp62-2, were reported to enhance antibacterial and antiviral immune responses and improve host survival [ 17]. Although the function of p62 had been extensively studied in a variety of organisms, the functions of p62 in regulating of oxidative stress induced by ammonia in L. vannamei is still unclear. In this study, RNAi-mediated knockdown was used to investigate the role of Lv-p62 in L. vannamei under ammonia exposure. We hypothesized that Lv-p62 participates in ammonia stress responses by modulating antioxidant defense, autophagy-related processes, and apoptosis. Antioxidant-, autophagy-, and apoptosis-related gene expression, hepatopancreatic tissue damage, and TUNEL-positive apoptotic signals were assessed to clarify the involvement of Lv-p62 in ammonia stress responses. This study provides functional evidence for the role of Lv-p62 in L. vannamei under ammonia exposure. 3. Results 3.1. Tissue Expression Sequence of Lv-p62 After Ammonia Exposure As shown in , the mRNA expression level of Lv-p62 in the hepatopancreas, gills, and intestine of L. vannamei was increased after ammonia exposure ( p < 0.05). In the hepatopancreas, Lv-p62 expression first increased to reach the first peak at 12 h, then decreased at 24 h, and subsequently rose again to reach the second, higher peak at 48 h, followed by a slight decline at 72 h. In the gills, Lv-p62 expression peaked at 6 h ( p < 0.05), followed by a gradual decrease in expression, and the level at 72 h remained higher than that at 0 h. In the intestine, Lv-p62 expression increased continuously and peaked at 24 h, then declined gradually. These results indicate that ammonia exposure increased Lv-p62 expression in a tissue-specific and time-dependent manner. 3.2. RNAi Efficiency Analysis The knockdown effect of Lv-p62 was assessed by qRT-PCR analysis in the hepatopancreas, gills and intestine. The relative expression level of Lv-p62 was reduced after dsRNA- Lv-p62 injection in all three tissues and reached its lowest level at 24 h after the second injection among the examined time points (). These results suggest that the silencing effect of Lv-p62 was most pronounced at 24 h after the second injection under the present experimental conditions. At later time points, Lv-p62 expression showed a partial recovery. 3.3. Antioxidant-Related Genes Expression As shown in , antioxidant-related genes exhibited tissue-specific expression patterns after Lv-p62 knockdown under ammonia exposure, with Gpx showing a prominent increase mainly in the gill and intestine. In the hepatopancreas, the Trx expression in the dsRNA- Lv-p62+NH 3 group was significantly higher than that in the dsRNA-EGFP+NH 3 group at 12 h, 48 h and 72 h ( p < 0.05). Gpx expression in the dsRNA-EGFP+NH 3 group decreased gradually to the lowest level at 48 h, whereas that in the dsRNA- Lv-p62+NH 3 group peaked at 72 h ( p < 0.05). Gst expression in the dsRNA- Lv-p62+NH 3 group peaked at 48 h and then decreased, whereas that in the dsRNA-EGFP+NH 3 group remained at a relatively high level after 24 h, with significant differences between the two groups at all detected time points ( p < 0.05). In the gills, Trx expression in the dsRNA- Lv-p62+NH 3 group was significantly lower than that in the dsRNA-EGFP+NH 3 group at 6, 24 and 48 h ( p < 0.05), Gst expression in the dsRNA- Lv-p62+NH 3 group was generally lower than that in the dsRNA-EGFP+NH 3 group at all post-exposure time points from 6 to 72 h ( p < 0.05), Gpx expression in the dsRNA- Lv-p62+NH 3 group was significantly higher than that in the dsRNA-EGFP+NH 3 group at all post-exposure time points from 6 to 72 h ( p < 0.05). In the intestine, Trx expression in the dsRNA- Lv-p62+NH 3 group was significantly higher than that in the dsRNA-EGFP+NH 3 group at 24 h and 48 h ( p < 0.05), Gpx expression in the dsRNA- Lv-p62+NH 3 group was significantly higher than that in the dsRNA-EGFP+NH 3 group at 6, 12, 48 and 72 h ( p < 0.05), and Gst expression in the dsRNA- Lv-p62+NH 3 group was significantly lower than that in the dsRNA-EGFP+NH 3 group across all time points ( p < 0.05), with Gst expression in the dsRNA- Lv-p62+NH 3 group reaching the minimum at 24 h while that in the dsRNA-EGFP+NH 3 group peaked at 24 h. 3.4. Autophagy-Related Genes Expression As exhibited in , in the hepatopancreas, the expression of ATG10 at all observation time points (6, 12, 24, 48 h) in the dsRNA-EGFP+NH 3 group was lower than that at 0 h, and the ATG10 expression levels in both the dsRNA- Lv-p62+NH 3 group and the dsRNA-EGFP+NH 3 group peaked at 72 h. Compared with the dsRNA-EGFP+NH 3 group, the expression of ATG10 in the dsRNA- Lv-p62+NH 3 group was significantly downregulated at 48 h and 72 h. The ATG4 expression in the dsRNA-EGFP+NH 3 group decreased during the early stage after ammonia exposure, then increased and reached its highest level at 48 h. In contrast, ATG4 expression in the dsRNA- Lv-p62+NH 3 group was suppressed during the early stage and did not rebound until 72 h. In gill tissue, the expression levels of ATG10ATG4 in the dsRNA- Lv-p62+NH 3 group showed a downward trend after ammonia exposure, and were significantly lower than those in the dsRNA-EGFP+NH 3 group ( p < 0.05). The expression level of ATG10 in the dsRNA-EGFP+NH 3 group initially increased and remained significantly higher than that at 0 h until 72 h ( p < 0.05). In the intestine, ATG10ATG4 in both the dsRNA-EGFP+NH 3 group and the dsRNA- Lv-p62+NH 3 group first increased and then decreased after ammonia exposure. ATG4 in the dsRNA-EGFP+NH 3 group reached its highest level at 12 h, whereas that in the dsRNA- Lv-p62+NH 3 group peaked at 48 h and then decreased. 3.5. Apoptosis Gene Expression As shown in , in the hepatopancreas, for the caspase 3 gene, the overall expression level in the dsRNA-EGFP+NH 3 group was significantly higher than that in the dsRNA- Lv-p62+NH 3 group at 6, 12, 48, and 72 h ( p < 0.05). However, at 24 h, the opposite pattern was observed: caspase 3 expression was significantly higher in the dsRNA- Lv-p62+NH 3 group than in the dsRNA-EGFP+NH 3 group ( p < 0.05), and reached its peak in the dsRNA- Lv-p62+NH 3 group. The p53 expression in the dsRNA- Lv-p62+NH 3 group was significantly lower than that in the dsRNA-EGFP+NH 3 group at 12, 48, and 72 h ( p < 0.05). In the gill, the caspase 3 in dsRNA-EGFP+NH 3 group reached its peak expression at 48 h, while the dsRNA- Lv-p62+NH 3 group peaked at 24 h and 48 h. Additionally, the caspase 3 expression level in the dsRNA- Lv-p62+NH 3 group was significantly lower than that in the dsRNA-EGFP+NH 3 group at 6, 48, and 72 h ( p < 0.05). p53 expression levels in both the dsRNA-EGFP+NH 3 and dsRNA- Lv-p62+NH 3 groups were significantly lower than those at 0 h ( p < 0.05). In the intestine, the expression levels of caspase 3 in the dsRNA-EGFP+NH 3 were significantly upregulated after ammonia exposure ( p < 0.05). The expression level of caspase 3 in the dsRNA-EGFP+NH 3 group was significantly higher than that in the dsRNA- Lv-p62+NH 3 group at 6, 12, 24, 48, and 72 h ( p < 0.05). For the p53 gene, the dsRNA-EGFP+NH 3 group reached its peak expression at 6 h, followed by an overall downward trend. In contrast, the dsRNA- Lv-p62+NH 3 group showed fluctuating expression, with the highest level observed at 48 h. 3.6. Effects of Lv-p62 RNAi on Hepatopancreatic Histopathology As observed in , in the dsRNA-EGFP group, the hepatopancreatic acini were star-shaped with intact structures. However, in the dsRNA-EGFP+NH 3 group, the walls of hepatopancreatic acini became thinner and distorted, and the normal structure was lost, with obvious vacuolation. The histopathological alterations were mainly characterized by acinar wall thinning, structural distortion, loss of normal architecture, and vacuolation, whereas obvious necrosis or epithelial sloughing was not observed in the examined sections. In contrast, vacuolation of hepatopancreatic acini in the dsRNA- Lv-p62+NH 3 group was reduced, and the acinar structure was largely preserved, with morphology closer to that of the dsRNA-EGFP group. 3.7. TUNEL Detection Analysis As illustrated in , apoptotic signals were detected by the TUNEL assay, with green fluorescence indicating apoptotic cells. Representative images from multiple randomly selected sections are shown. More obvious apoptotic signals were observed in the dsRNA-EGFP+NH 3 group, whereas relatively weaker apoptotic signals were observed in the dsRNA-EGFP group and the dsRNA- Lv-p62+NH 3 group. Quantitative analysis further confirmed that the cell apoptosis rate was increased in the dsRNA-EGFP+NH 3 group, whereas this increase was reduced in the dsRNA- Lv-p62+NH 3 group (). 4. Discussion P62 acts as a selective autophagy receptor and mediates protein aggregate degradation via its functional domains, thereby contributing to intracellular homeostasis [ 19, 20]. p62 also activates the Nrf2 pathway to upregulate antioxidant gene expression. For example, exercise-induced upregulation of antioxidant proteins depends on p62-mediated Nrf2 activation [ 21]. In addition, p62-mediated selective autophagy contributes to immune regulation and host defense [ 22]. Our previous studies showed that Lv-p62 was involved in the immune response against Vibrio harveyi infection [ 13]. However, the role of Lv-p62 in the response of L. vannamei to ammonia exposure remains unclear. Ammonia exposure causes tissue damage, oxidative stress, and metabolic disorders in L. vannamei [ 1]. We performed ammonia exposure and Lv-p62 RNAi experiments, measuring gene expression in the hepatopancreas, gills, and intestine to evaluate the involvement of Lv-p62 in ammonia-induced oxidative stress. After ammonia exposure, Lv-p62 expression was significantly upregulated in all three tissues. Similar upregulation of p62 has been reported under starvation-induced oxidative stress in the intestine of Pelodiscus sinensis [ 23]. However, the peak expression time of Lv-p62 differed markedly among tissues, peaking at 6 h in the gill, 24 h in the intestine, whereas a biphasic response was observed in the hepatopancreas, with a first peak at 12 h and a higher second peak at 48 h. The biphasic expression of Lv-p62 in the hepatopancreas may reflect a stage-dependent response to ammonia stress. The first peak at 12 h may indicate an early transcriptional response to acute ammonia-induced cellular stress, whereas the higher peak at 48 h may be associated with accumulated cellular damage and enhanced Lv-p62-related autophagy/ubiquitin-associated stress signaling [ 10, 19]. This interpretation is consistent with the lower hepatopancreatic vacuolation and weaker TUNEL-positive signals observed in the dsRNA- Lv-p62+NH 3 group than in the dsRNA-EGFP+NH 3 group, suggesting that sustained Lv-p62 upregulation may be associated with the hepatopancreatic response under ammonia exposure. Since p62 can interact with Keap1 and promote Nrf2-mediated antioxidant responses, the second peak may indicate activation of a p62-Keap1-Nrf2-related adaptive response to prolonged oxidative stress [ 11, 15]. The different Gpx responses after Lv-p62 knockdown may be related to tissue-specific physiological functions. The gill and hepatopancreas show different toxicity responses under ammonia exposure [ 2], while the hepatopancreas has important roles in metabolism and immune regulation [ 24]. Therefore, Lv-p62 knockdown may affect antioxidant gene regulation differently among tissues, possibly through p62-related antioxidant signaling such as the Keap1–Nrf2 pathway [ 25]. Physiologically, the gill is the tissue directly exposed to ammonia, which may explain its earliest response in Lv-p62 expression under ammonia exposure [ 2]. Cong et al. also reported that the gill was the fastest-responding tissue in Ruditapes philippinarum under ammonia exposure [ 26]. These results suggest that Lv-p62 may be involved in ammonia-induced oxidative stress. Our results revealed tissue-specific expression patterns of antioxidant genes following ammonia exposure and Lv-p62 knockdown. Notably, Gpx expression in the dsRNA- Lv-p62+NH 3 group was significantly higher than that in the dsRNA-EGFP+NH 3 group in both the gill and intestine, whereas TrxGst expression mostly showed the opposite pattern. These changes suggest that Lv-p62 knockdown did not simply suppress the antioxidant system, but disturbed the balance of antioxidant gene regulation in a tissue-dependent manner. Mechanistically, this response may be closely associated with the p62–Keap1–Nrf2 signaling axis. Under oxidative stress, accumulated p62 can interact with Keap1, competitively inhibit Keap1-mediated repression of Nrf2, and thereby promote Nrf2 stabilization and transcriptional activation of antioxidant and detoxification genes [ 25, 27]. Ammonia-induced ROS accumulation may disrupt redox homeostasis, promote oxidative damage, and induce increased apoptotic signals [ 7]. In addition, ammonia nitrogen stress can induce oxidative stress and autophagy-related responses in the shrimp hepatopancreas [ 14]. In the present study, hepatopancreatic structural damage, vacuolation, and increased TUNEL-positive signals were observed under short-term ammonia exposure, whereas the dsRNA- Lv-p62+NH 3 group showed milder histological alterations and weaker TUNEL-positive signals than the dsRNA-EGFP+NH 3 group. These results suggest that Lv-p62 may participate in the acute hepatopancreatic response to ammonia stress; however, whether this effect persists under long-term ammonia exposure requires further investigation. The increased Gpx expression in the gill and intestine after Lv-p62 knockdown may represent a compensatory response to enhanced oxidative pressure or activation of alternative antioxidant pathways. In contrast, the hepatopancreas did not show the same Gpx upregulation, which may be related to its central metabolic and detoxification functions and its greater susceptibility to ammonia-induced cellular damage. Under severe or prolonged stress, hepatopancreatic cells may have limited capacity to further activate Gpx transcription after Lv-p62 knockdown. Another possible explanation is that antioxidant regulation in the hepatopancreas depends more strongly on the p62–Keap1–Nrf2 axis, whereas the gill and intestine may activate additional compensatory pathways because they are directly exposed to environmental ammonia or involved in barrier defense. Conversely, as reported in previous studies, p62 knockdown can indirectly upregulate certain antioxidant genes by restoring FOXO1/3 expression [ 28]. Thus, the increased Gpx expression observed in the gill and intestine after Lv-p62 knockdown may represent a compensatory response to enhanced oxidative pressure or activation of alternative antioxidant pathways [ 28], whereas the decreased or less responsive expression of TrxGst may reflect impaired Nrf2/Keap1-mediated transcriptional regulation [ 25, 27]. These findings imply that Lv-p62 modulates antioxidant responses in a tissue-specific manner, probably via the Nrf2 pathway. The expression of ATG4ATG10 in the hepatopancreas in the dsRNA-EGFP+NH 3 group and the dsRNA- Lv-p62+NH 3 group showed a downward trend after ammonia exposure. The result is consistent with a previous report [ 14]. Compared with the dsRNA-EGFP+NH 3 group, ATG10 expression in the gill and intestine was significantly downregulated in the dsRNA- Lv-p62+NH 3 group. We have previously found that knocking down p62 led to the downregulation of autophagy gene expression [ 13]. These results indicate that p62 is involved in regulating autophagy. The expression of caspase 3 in all tested tissues in the dsRNA-EGFP+NH 3 group was upregulated at 6 h after ammonia exposure. Ammonia and Vibrio infection might trigger apoptosis [ 13, 29]. Overall, the expression of caspase 3p53 was higher in the dsRNA-EGFP+NH 3 group than in the dsRNA- Lv-p62+NH 3 group. This is similar to the results in the Vibrio infection experiment [ 13]. TUNEL analysis showed that the dsRNA- Lv-p62+NH 3 group had fewer TUNEL-positive signals than the dsRNA-EGFP+NH 3 group. Knockdown of p62 could reduce the apoptosis of U87MG human glioma cells [ 30]. Collectively, these results suggest that Lv-p62 may be involved in apoptosis-related responses during ammonia exposure in L. vannamei. For crustaceans, the hepatopancreas is an important organ with multiple functions [ 24]. Therefore, histological analysis in this study was focused on the hepatopancreas because it is a major immune, metabolic, and detoxification organ in crustaceans and is highly sensitive to ammonia-induced oxidative damage [ 7, 24, 31]. Ding et al. found that black shrimp exposed to acute ammonia exposure exhibited hepatopancreatic oxidative damage, and this result is similar to that observed in the present study [ 31]. Hepatopancreatic acini in the dsRNA- Lv-p62+NH 3 group also exhibited vacuolation, but the degree of vacuolar damage was lower than that in the dsRNA-EGFP+NH 3 group. These findings suggest that Lv-p62 may be associated with hepatopancreatic apoptosis-related responses and tissue damage under short-term ammonia exposure. Qian et al. also found that liver damage in mice with p62 knockdown could be effectively repaired at 48 h after APAP-induced liver injury [ 32]. These observations are consistent with the possibility that Lv-p62 is involved in hepatopancreatic apoptosis-related responses and tissue damage under ammonia exposure. In the present experimental design, the effects of Lv-p62 knockdown were evaluated under ammonia exposure by comparing the dsRNA-EGFP+NH 3 and dsRNA- Lv-p62+NH 3 groups. Therefore, the interpretation of these results was limited to the comparison between these two groups under short-term ammonia exposure. In addition, the newly added RNAi efficiency data under non-ammonia conditions confirmed the effective knockdown of Lv-p62, supporting the reliability of the RNAi strategy used in this study. Accordingly, the conclusions were framed to describe the involvement of Lv-p62 in responses to ammonia exposure, rather than its basal function under non-ammonia conditions. Further studies should validate the proposed mechanism at the protein and functional levels, including protein abundance, enzyme activity, Nrf2 activation, determination of un-ionized ammonia levels, and quantitative histological assessment across multiple time points. In this study, ammonia exposure combined with RNAi was used to investigate the function of Lv-p62 in the ammonia exposure response of L. vannamei. Knockdown of Lv-p62 altered the tissue-specific expression patterns of antioxidant-, autophagy-, and apoptosis-related genes, and alleviated ammonia-induced hepatopancreatic injury and apoptosis. These findings suggest that Lv-p62 participates in mediating ammonia-induced oxidative stress and tissue damage in L. vannamei. Overall, this study provides new insight into the role of Lv-p62 in ammonia stress adaptation in shrimp. Author Contributions Conceptualization, W.L., J.L. and L.F.; methodology, W.L. and J.J.; investigation, W.L., J.L. and S.C.; validation, J.L., L.F. and S.C.; resources, J.L. and J.J.; data curation, W.L. and J.L.; visualization, L.F.; writing—original draft preparation, W.L.; writing—review and editing, S.Y.; project administration, S.Y.; funding acquisition, S.Y. All authors have read and agreed to the published version of the manuscript. Funding This work was funded by the Innovative Team Building Project of Guangdong Modern Agricultural Industrial Technology System (Grant 2026CXTD27), Zhanjiang Science and Technology Plan Project (2025522), the Modern Seed Industry Park for White-leg Shrimp of Guang dong Province (Grant K22219). Institutional Review Board Statement The use of all animals in this project was conducted under the Animal Welfare Act, the PHS Animal Welfare Policy, the National Institutes of Health (NIH) Guide for Care and Use of Laboratory Animals, and the policies and procedures of the People’s Republic of China, Guangdong province, and Guangdong Ocean University. The study was conducted incompliance with the regulations for administering laboratory animals in Guangdong province, Chinand in compliance with the Guangdong Ocean University Research Council’s guidelines for the care and use of laboratory animals (approval number: GDOU-LAE-2026-054, approval date: 5 December 2025). Informed Consent Statement Not applicable. Data Availability Statement Upon a reasonable request, the corresponding author will provide the data supporting the results of this study. Conflicts of Interest The authors declare no conflicts of interest. Abbreviations The following abbreviations are used in this manuscript: SQSTM1 Sequestosome 1 Lv-p62 Litopenaeus vannamei p62 RNAi RNA interference dsRNA Double-stranded RNA EGFP Enhanced green fluorescent protein qRT-PCR Quantitative real-time polymerase chain reaction ROS Reactive oxygen species Nrf2 Nuclear factor E2-related factor 2 ARE Antioxidant response elements Keap1 Kelch-like ECH-associated protein 1 Trx Thioredoxin Gst Glutathione S-transferase Gpx Glutathione peroxidase ATG Autophagy-related gene caspase 3 Cysteinyl aspartate specific proteinase 3 p53 Tumor protein 53 HE Hematoxylin–eosin TUNEL Terminal deoxynucleotidyl transferase dUTP nick-end labeling EF-1α Elongation factor 1 alpha NH 3Ammonia NH 4Cl Ammonium chloride Appendix A The primers used for qRT-PCR are listed in Table A1. Table A1. Sequences of primers used in this study. Table A1. Sequences of primers used in this study. Gene Names Sequence (5′–3′) dsp62-T7F TAATACGACTCACTATAGGGAGGATCTCTGTGCTGCCTGCGAGTTTA dsp62-T7R TAATACGACTCACTATAGGGAGTGTCCAAGGACATTCCTTGTCTTTG dsEGFP-T7F TAATACGACTCACTATAGGGAGGTGCCCATCCTGGTCGAGCT dsEGFP-T7R TAATACGACTCACTATAGGGAGTGCACGCTGCCGTCCTCGAT p62-F ATGTCAGACGACAGAAGCATGAGCG p62-R TTATTTGTTGACTGGCTGAAGAATG qTrx-F TTAACGAGGCTGGAAACA qTrx-R AACGACATCGCTCATAGA qGst-F AAGATAACGCAGAGCAAGG qGst-R TCGTAGGTGACGGTAAAGA qGpx-F AGGGACTTCCACCAGATG qGpx-R CAACAACTCCCCTTCGGTA qAtg4-F CTTTGTTGGTGATGAGGTCGTCTA qAtg4-R ACTTGTCTGTTTCCACTTCCGTTT qAtg10-F CAATCACTCGGGTAAACTTCT qAtg10-R GGATGCTCTTGTTGCGTCAGG qP53-F ATCCCGTGGGATTCTCTCCA qP53-R ATTTGTGACGACCTGCCCAT qCaspase3-F AACCAAGGCATCCCTGTCA qCaspase3-R GGGTTTATTCTGAAGTTGTGGG EF1α-F GTATTGGAACAGTGCCCGTG EF1α-RACCAGGGACAGCCTCAGTAAG References Lin, L.; Zhuo, H.; Zhang, Y.; Li, J.; Zhou, X.; Wu, G.; Guo, C.; Liu, J. Effects of Ammonia Exposure and Post-Exposure Recovery in Pacific White Shrimp, Litopenaeus vannamei: Histological, Physiological and Molecular Responses. Aquat. Toxicol. 2024, 277, 107133. [ Google Scholar] [ CrossRef] [ PubMed] Zhang, Y.; Liu, J.; Zhuo, H.; Lin, L.; Li, J.; Fu, S.; Xue, H.; Wen, H.; Zhou, X.; Guo, C.; et al. Differential Toxicity Responses between Hepatopancreas and Gills in Litopenaeus vannamei under Chronic Ammonia-N Exposure. Animals 2023, 13, 3799. [ Google Scholar] [ CrossRef] Frías-Espericueta, M.G.; Harfush-Melendez, M.; Páez-Osuna, F. Effects of Ammonia on Mortality and Feeding of Postlarvae Shrimp Litopenaeus vannamei. Bull. Environ. Contam. Toxicol. 2000, 65, 98–103. [ Google Scholar] [ CrossRef] Edwards, T.M.; Puglis, H.J.; Kent, D.B.; Durán, J.L.; Bradshaw, L.M.; Farag, A.M. Ammonia and Aquatic Ecosystems—A Review of Global Sources, Biogeochemical Cycling, and Effects on Fish. Sci. Total Environ. 2024, 907, 167911. [ Google Scholar] [ CrossRef] Yun, S.C.; Jeong, H.; Lee, J.-S.; Kim, J.-H.; Kim, I.-C.; Maszczyk, P.; Yang, Z.; Hagiwara, A.; Lee, J.-S. A Review of Ammonia Toxicity on Aquatic Organisms: Species-Specific Responses, Microbial Shifts, and Environmental Interactions. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2026, 300, 110388. [ Google Scholar] [ CrossRef] Li, X.; Wang, S.; Zhang, M.; Li, M. Enhancement of Autophagy Can Alleviate Oxidative Stress, Inflammation, and Apoptosis Induced by Ammonia Stress in Yellow Catfish Pelteobagrus fulvidraco. Fish Shellfish. Immunol. 2024, 149, 109582. [ Google Scholar] [ CrossRef] Liang, Z.; Liu, R.; Zhao, D.; Wang, L.; Sun, M.; Wang, M.; Song, L. Ammonia Exposure Induces Oxidative Stress, Endoplasmic Reticulum Stress and Apoptosis in Hepatopancreas of Pacific White Shrimp ( Litopenaeus vannamei). Fish Shellfish. Immunol. 2016, 54, 523–528. [ Google Scholar] [ CrossRef] Bian, D.-D.; Shi, Y.-X.; Zhang, X.; Liu, X.; Jiang, J.-J.; Zhu, X.-R.; Zhang, D.-Z.; Liu, Q.-N.; Zhu, B.-J.; Tang, B.-P. Nitrite Toxicity in Shrimp Aquaculture: Mechanisms, Health Impacts, and Sustainable Mitigation Strategies. Rev. Aquac. 2025, 17, e70062. [ Google Scholar] [ CrossRef] Ortega, M.A.; García-Montero, C.; Fraile-Martínez, O.; García-Honduvilla, N.; Álvarez-Mon, M.; Buján, J.; Asúnsolo, Á. Autophagy in Its (Proper) Context: Molecular Basis, Biological Functions, and Therapeutic Perspectives. Cells 2024, 13, 1016. [ Google Scholar] [ CrossRef] Kim, S.; Lee, W.; Cho, K. p62 Links the Autophagy Pathway and the Ubiquitin–Proteasome System in Endothelial Cells during Atherosclerosis. Int. J. Mol. Sci. 2021, 22, 7791. [ Google Scholar] [ CrossRef] [ PubMed] Katsuragi, Y.; Ichimura, Y.; Komatsu, M. Regulation of the Keap1–Nrf2 Pathway by p62/SQSTM1. Curr. Opin. Toxicol. 2016, 1, 54–61. [ Google Scholar] [ CrossRef] Hennig, P.; Fenini, G.; Di Filippo, M.; Karakaya, T.; Beer, H.-D. The Pathways Underlying the Multiple Roles of p62 in Inflammation and Cancer. Biomedicines 2021, 9, 707. [ Google Scholar] [ CrossRef] Luo, J.; Lu, W.; Chen, Y.; Li, G.; Feng, J.; Huang, Y.; Yu, Y.; Cai, S.; Jian, J.; Yang, S. SQSTM1/p62 from Litopenaeus vannamei Is Involved in the Immune Response to Vibrio Infection. Fish Shellfish. Immunol. 2025, 158, 110161. [ Google Scholar] [ CrossRef] [ PubMed] Wang, F.; Huang, L.; Liao, M.; Dong, W.; Liu, C.; Zhuang, X.; Liu, Y.; Yin, X.; Liang, Q.; Wang, W. Pva-miR-252 Participates in Ammonia Nitrogen-Induced Oxidative Stress by Modulating Autophagy in Penaeus vannamei. Ecotoxicol. Environ. Safe 2021, 225, 112774. [ Google Scholar] [ CrossRef] Wu, J.; Hou, S.; Yang, L.; Wang, Y.; Wen, C.; Guo, Y.; Luo, S.; Fang, H.; Jiao, H.; Xu, H.; et al. p62/SQSTM1 Upregulates NQO1 Transcription via Nrf2/Keap1a Signaling Pathway to Resist Microcystins-Induced Oxidative Stress in Freshwater Mussel Cristaria plicata. Aquat. Toxicol. 2023, 255, 106398. [ Google Scholar] [ CrossRef] Wei, C.-C.; Luo, Z.; Song, Y.-F.; Pan, Y.-X.; Zhuo, M.-Q. Characterization of Twelve Autophagy-Related Genes from Yellow Catfish Pelteobagrus fulvidraco and Their Transcriptional Responses to Waterborne Zinc Exposure. Ecol. Indic. 2018, 93, 677–686. [ Google Scholar] [ CrossRef] Zhang, Y.; Li, C.; Zhang, M.; Gao, F.; Zhao, Y.; Kong, X. Selective Autophagy Receptor p62 Promotes Antibacterial and Antiviral Immunity in Common Carp ( Cyprinus carpio). Fish Shellfish. Immunol. 2024, 151, 109719. [ Google Scholar] [ CrossRef] Huang, Y.; Li, Q.; Yang, S.; Yuan, Y.; Zhang, Z.; Jiang, B.; Lv, J.; Zhong, J.; Jian, J. Identification and Characterization of Heme Oxygenase-1 from Litopenaeus vannamei Involved in Antioxidant and Anti-Apoptosis under Ammonia Stress. Fishes 2022, 7, 356. [ Google Scholar] [ CrossRef] Lin, X.; Li, S.; Zhao, Y.; Ma, X.; Zhang, K.; He, X.; Wang, Z. Interaction Domains of p62: A Bridge between p62 and Selective Autophagy. DNA Cell Biol. 2013, 32, 220–227. [ Google Scholar] [ CrossRef] Liu, H.; Dai, C.; Fan, Y.; Guo, B.; Ren, K.; Sun, T.; Wang, W. From Autophagy to Mitophagy: The Roles of p62 in Neurodegenerative Diseases. J. Bioenerg. Biomembr. 2017, 49, 413–422. [ Google Scholar] [ CrossRef] Yamada, M.; Iwata, M.; Warabi, E.; Oishi, H.; Lira, V.A.; Okutsu, M. p62/SQSTM1 and Nrf2 Are Essential for Exercise-Mediated Enhancement of Antioxidant Protein Expression in Oxidative Muscle. FASEB J. 2019, 33, 8022–8032. [ Google Scholar] [ CrossRef] Huang, M.; Zhang, W.; Yang, Y.; Shao, W.; Wang, J.; Cao, W.; Zhu, Z.; Yang, F.; Zheng, H. From Homeostasis to Defense: Exploring the Role of Selective Autophagy in Innate Immunity and Viral Infections. Clin. Immunol. 2024, 262, 110169. [ Google Scholar] [ CrossRef] [ PubMed] Shi, X.; Yue, D.; Guo, Q.; Li, X.; Zhang, P.; Liu, H. Starvation Affects the Intestinal Oxidative Stress, Autophagy, Microbiota and Histology of Chinese Soft-Shelled Turtle ( Pelodiscus sinensis). Aquacult. Rep. 2025, 42, 102835. [ Google Scholar] [ CrossRef] Rőszer, T. The Invertebrate Midintestinal Gland (“Hepatopancreas”) Is an Evolutionary Forerunner in the Integration of Immunity and Metabolism. Cell Tissue Res. 2014, 358, 685–695. [ Google Scholar] [ CrossRef] Komatsu, M.; Kurokawa, H.; Waguri, S.; Taguchi, K.; Kobayashi, A.; Ichimura, Y.; Sou, Y.-S.; Ueno, I.; Sakamoto, A.; Tong, K.I.; et al. The Selective Autophagy Substrate p62 Activates the Stress Responsive Transcription Factor Nrf2 through Inactivation of Keap1. Nat. Cell Biol. 2010, 12, 213–223. [ Google Scholar] [ CrossRef] Cong, M.; Wu, H.; Cao, T.; Ji, C.; Lv, J. Effects of Ammonia Nitrogen on Gill Mitochondria in Clam Ruditapes philippinarum. Environ. Toxicol. Pharmacol. 2019, 65, 46–52. [ Google Scholar] [ CrossRef] Jain, A.; Lamark, T.; Sjøttem, E.; Bowitz Larsen, K.; Atesoh Awuh, J.; Øvervatn, A.; McMahon, M.; Hayes, J.D.; Johansen, T. p62/SQSTM1 Is a Target Gene for Transcription Factor NRF2 and Creates a Positive Feedback Loop by Inducing Antioxidant Response Element-Driven Gene Transcription. J. Biol. Chem. 2010, 285, 22576–22591. [ Google Scholar] [ CrossRef] Zhao, L.; Li, H.; Wang, Y.; Zheng, A.; Cao, L.; Liu, J. Autophagy Deficiency Leads to Impaired Antioxidant Defense via p62-FOXO1/3 Axis. Oxidative Med. Cell. Longev. 2019, 2019, 2526314. [ Google Scholar] [ CrossRef] Zhang, M.; Li, M.; Wang, R.; Qian, Y. Effects of Acute Ammonia Toxicity on Oxidative Stress, Immune Response and Apoptosis of Juvenile Yellow Catfish Pelteobagrus fulvidraco and the Mitigation of Exogenous Taurine. Fish Shellfish. Immunol. 2018, 79, 313–320. [ Google Scholar] [ CrossRef] [ PubMed] Zhang, Y.-B.; Gong, J.-L.; Xing, T.-Y.; Zheng, S.-P.; Ding, W. Autophagy Protein p62/SQSTM1 Is Involved in HAMLET-Induced Cell Death by Modulating Apotosis in U87MG Cells. Cell Death Dis. 2013, 4, e550. [ Google Scholar] [ CrossRef] [ PubMed] Ding, Y.; Jiang, S.; Jiang, S.; Li, Y.; Yang, Q.; Yang, L.; Huang, J.; Shi, J.; Li, P.; Diao, H.; et al. Metabolic Response of Black Tiger Shrimp ( Penaeus monodon) to Acute Ammonia Nitrogen Stress. Biology 2025, 14, 501. [ Google Scholar] [ CrossRef] [ PubMed] Qian, H.; Bai, Q.; Yang, X.; Akakpo, J.Y.; Ji, L.; Yang, L.; Rülicke, T.; Zatloukal, K.; Jaeschke, H.; Ni, H.-M.; et al. Dual Roles of p62/SQSTM1 in the Injury and Recovery Phases of Acetaminophen-Induced Liver Injury in Mice. Acta Pharm. Sin. B 2021, 11, 3791–3805. [ Google Scholar] [ CrossRef] [ PubMed] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. © 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license. Share and Cite MDPI and ACS Style Lu, W.; Luo, J.; Feng, L.; Cai, S.; Jian, J.; Yang, S. The SQSTM1/ p62 of Pacific White Shrimp ( Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure. Animals 2026, 16, 1718. https://doi.org/10.3390/ani16111718 AMA Style Lu W, Luo J, Feng L, Cai S, Jian J, Yang S. The SQSTM1/ p62 of Pacific White Shrimp ( Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure. Animals. 2026; 16(11):1718. https://doi.org/10.3390/ani16111718 Chicago/Turabian Style Lu, Wei, Junliang Luo, Leyuan Feng, Shuanghu Cai, Jichang Jian, and Shiping Yang. 2026. "The SQSTM1/ p62 of Pacific White Shrimp ( Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure" Animals 16, no. 11: 1718. https://doi.org/10.3390/ani16111718 APA Style Lu, W., Luo, J., Feng, L., Cai, S., Jian, J., & Yang, S. (2026). The SQSTM1/ p62 of Pacific White Shrimp ( Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure. Animals, 16(11), 1718. https://doi.org/10.3390/ani16111718 Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details . Article Metrics Article metric data becomes available approximately 24 hours after publication online.
The SQSTM1/p62 of Pacific White Shrimp (Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure